[Python] Iterare una sequenza

[Giuseppe Costanzi]

ciao federico,

il secondo metodo mi piace, tra l' altro ho notato che itera solo 22 volte
mentre il mio 28.
in pratica vai a blocchi di lunghezza uguale al target invece di andare una
base alla volta.
bello, mi piace questa soluzione.

grazie


2017-11-26 11:06 GMT+01:00 Federico Cerchiari <federicocerchiari a gmail.com>:

> Ciao Giuseppe,
>
> per trovare la posizione di un oggetto in una sequenza (lista, stringa o
> altro) puoi usare il metodo '.index' delle liste:
>
> dna_seq = 'ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT'
> target = 'GAATTCT'
> target_position = dna_seq.index(target) + 1
> print('lunghezza pre-target: %d, post-target %d' % (target_position,
> len(dna_seq)-target_position))
>
> Se vuoi iterare sulla sequenza per farci altro fai bene a usare
> 'enumerate', ma invece di costruirti la stringa di comparazione di volta in
> volta puoi prelevarla dalla stringa originale ad ogni ciclo:
>
> for position, gene in enumerate(dna_seq):
> if dna_seq[position:position+len(target)] == target:
> position += 1  # Aggiungiamo 1 perchè enumerate è 0-based
> print('lunghezza pre-target: %d, post-target %d' % (position,
> len(dna_seq)-position))
>
> Federico
>
> 2017-11-26 10:42 GMT+01:00 Giuseppe Costanzi <giuseppecostanzi a gmail.com>:
>
>> ciao carlo,
>>
>> si, interessante ma vorrei iterare la sequenza mano a mano,
>>
>> stavo pensando a qualcosa tipo
>>
>> next(iterator, default)
>>
>> grazie comunque
>>
>>
>>
>> On Sun, Nov 26, 2017 at 10:30 AM, Carlo Miron <miron a python.it> wrote:
>> > On Sun, Nov 26, 2017 at 10:20 AM, Giuseppe Costanzi
>> > <giuseppecostanzi a gmail.com> wrote:
>> >
>> >> ho una sequenza del tipo
>> >> ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT
>> >> scorrendola devo trovare una sequenza target GAATTC
>> >> ACTGATCGATTACGTATAGTA  "GAATTC"  TATCATACATATATATCGATGCGTTCAT
>> >> quindi dividere la sequenza da G, la prima lettera della sequenza
>> target,
>> >> e calcolarmi la lunghezza dei due frammenti risultanti
>> >> ACTGATCGATTACGTATAGTAG
>> >> e di questa
>> >> GAATTCTATCATACATATATATCGATGCGTTCAT
>> >
>> > qualcosa tipo
>> >
>> >>>> seq = "ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT"
>> >>>> target = "GAATTCT"
>> >>>> first, second = seq.split(target, 1)
>> >>>> first += target[1]
>> >>>> second = target[1:] + second
>> >>>> len(first), len(second)
>> > (22, 33)
>> >
>> > ?
>> > ㎝
>> >
>> > --
>> > |:**THE 🍺-WARE LICENSE** *(Revision ㊷)*:
>> > | <miron@🐍.it> wrote this mail. As long as you retain this
>> > | notice you can do whatever you want with this stuff.
>> > | If we meet some day, and you think this stuff is worth it,
>> > | you can buy me a 🍺 in return. —㎝
>> > _______________________________________________
>> > Python mailing list
>> > Python a lists.python.it
>> > https://lists.python.it/mailman/listinfo/python
>> _______________________________________________
>> Python mailing list
>> Python a lists.python.it
>> https://lists.python.it/mailman/listinfo/python
>>
>
>
> _______________________________________________
> Python mailing list
> Python a lists.python.it
> https://lists.python.it/mailman/listinfo/python
>
>
-------------- parte successiva --------------
Un allegato HTML è stato rimosso...
URL: <http://lists.python.it/pipermail/python/attachments/20171126/62b58ac7/attachment-0001.html>