[Python] Iterare una sequenza
Federico Cerchiari
federicocerchiari a gmail.com
Dom 26 Nov 2017 11:06:10 CET
Ciao Giuseppe,
per trovare la posizione di un oggetto in una sequenza (lista, stringa o
altro) puoi usare il metodo '.index' delle liste:
dna_seq = 'ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT'
target = 'GAATTCT'
target_position = dna_seq.index(target) + 1
print('lunghezza pre-target: %d, post-target %d' % (target_position,
len(dna_seq)-target_position))
Se vuoi iterare sulla sequenza per farci altro fai bene a usare
'enumerate', ma invece di costruirti la stringa di comparazione di volta in
volta puoi prelevarla dalla stringa originale ad ogni ciclo:
for position, gene in enumerate(dna_seq):
if dna_seq[position:position+len(target)] == target:
position += 1 # Aggiungiamo 1 perchè enumerate è 0-based
print('lunghezza pre-target: %d, post-target %d' % (position,
len(dna_seq)-position))
Federico
2017-11-26 10:42 GMT+01:00 Giuseppe Costanzi <giuseppecostanzi a gmail.com>:
> ciao carlo,
>
> si, interessante ma vorrei iterare la sequenza mano a mano,
>
> stavo pensando a qualcosa tipo
>
> next(iterator, default)
>
> grazie comunque
>
>
>
> On Sun, Nov 26, 2017 at 10:30 AM, Carlo Miron <miron a python.it> wrote:
> > On Sun, Nov 26, 2017 at 10:20 AM, Giuseppe Costanzi
> > <giuseppecostanzi a gmail.com> wrote:
> >
> >> ho una sequenza del tipo
> >> ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT
> >> scorrendola devo trovare una sequenza target GAATTC
> >> ACTGATCGATTACGTATAGTA "GAATTC" TATCATACATATATATCGATGCGTTCAT
> >> quindi dividere la sequenza da G, la prima lettera della sequenza
> target,
> >> e calcolarmi la lunghezza dei due frammenti risultanti
> >> ACTGATCGATTACGTATAGTAG
> >> e di questa
> >> GAATTCTATCATACATATATATCGATGCGTTCAT
> >
> > qualcosa tipo
> >
> >>>> seq = "ACTGATCGATTACGTATAGTAGAATTCTATCATACATATATATCGATGCGTTCAT"
> >>>> target = "GAATTCT"
> >>>> first, second = seq.split(target, 1)
> >>>> first += target[1]
> >>>> second = target[1:] + second
> >>>> len(first), len(second)
> > (22, 33)
> >
> > ?
> > ㎝
> >
> > --
> > |:**THE 🍺-WARE LICENSE** *(Revision ㊷)*:
> > | <miron@🐍.it> wrote this mail. As long as you retain this
> > | notice you can do whatever you want with this stuff.
> > | If we meet some day, and you think this stuff is worth it,
> > | you can buy me a 🍺 in return. —㎝
> > _______________________________________________
> > Python mailing list
> > Python a lists.python.it
> > https://lists.python.it/mailman/listinfo/python
> _______________________________________________
> Python mailing list
> Python a lists.python.it
> https://lists.python.it/mailman/listinfo/python
>
-------------- parte successiva --------------
Un allegato HTML è stato rimosso...
URL: <http://lists.python.it/pipermail/python/attachments/20171126/5292b089/attachment.html>
Maggiori informazioni sulla lista
Python